Find a Position in a Genome Minimizing the Skew solved by 2557

Define the skew of a DNA string Genome, denoted Skew(Genome), as the difference between the total number of occurrences of 'G' and 'C' in Genome. Let Prefix_i (Genome) denote the prefix (i.e., initial substring) of Genome of length i. For example, the values of Skew(Prefix_i ("$\color{red}\textbf{C}\color{black}\text{AT}\color{green}\textbf{GGG}\color{red}\textbf{C}\color{black}\text{AT}\color{red}\textbf{C}\color{green}\textbf{GG}\color{red}\textbf{CC}\color{black}\text{ATA}\color{red}\textbf{C}\color{green}\textbf{G}\color{red}\textbf{CC}$")) are:

0 -1 -1 -1 0 1 2 1 1 1 0 1 2 1 0 0 0 0 -1 0 -1 -2

Minimum Skew Problem

Find a position in a genome minimizing the skew.

Given: A DNA string Genome.

Return: All integer(s) i minimizing Skew(Prefix_i (Text)) over all values of i (from 0 to |Genome|).

Sample Dataset

CCTATCGGTGGATTAGCATGTCCCTGTACGTTTCGCCGCGAACTAGTTCACACGGCTTGATGGCAAATGGTTTTTCCGGCGACCGTAATCGTCCACCGAG

Sample Output

53 97

Extra Datasets

Click for debug datasets